Sequence ID | >SRA1014820 |
Genome ID | SRR023845.326775 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 141 |
End posion on genome | 54 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gacagacacc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGTACCTGACTCGAAATCAGGCGTACGGAAACGTACC |
Downstream region at tRNA end position |
gcaatggatt |
Secondary structure (Cloverleaf model) | >SRA1014820 Ser CGA c TCCA gcaatggatt G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A T G A G | | | | | G G G A C G G A G G G C G | | + T T T A T G T C G A A CGTACGGAAACGTACC C - G C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |