Sequence ID | >SRA1014821 |
Genome ID | SRR023845.327274 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 203 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tcagaggctt |
tRNA gene sequence |
CGGTGTGTGGCGCAGCCTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
acacgggaac |
Secondary structure (Cloverleaf model) | >SRA1014821 Pro GGG t ACCA acacgggaac C - G G - C G - C T - A G - C T - A G - C T A T T T T C C A C G A G + | | | | G C C G C G G A A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |