Sequence ID | >SRA1014826 |
Genome ID | SRR023845.331886 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 73 |
End posion on genome | -1 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cgcgcgccgt |
tRNA gene sequence |
AGGAGTGTAGCTCAACTGGTCAGAGCACCGGTCTCCAAAACCGGGGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1014826 Trp CCA t NNnn nnnnnnnnnn A A G - C G - C A - T G - C T - A G - C T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T C A A GGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |