Sequence ID | >SRA1014828 |
Genome ID | SRR023845.332947 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 149 |
End posion on genome | 76 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cacgttttat |
tRNA gene sequence |
TGCCCCGTCGCCAAGCGGTAAGGCACCTGACTCTGACTCAGGCATCGGTGGTTCGAATCC |
Downstream region at tRNA end position |
aacacgaaag |
Secondary structure (Cloverleaf model) | >SRA1014828 Gln CTG t GCCA aacacgaaag T - A G - C C - G C - G C - G C - G G - C T A T C T A C C A G A C | + | | | G C A C C G G G T G G C G | | | T T G A G G C T A A CATC C - G C - G T - A G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |