Sequence ID | >SRA1014829 |
Genome ID | SRR023845.333321 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 134 |
End posion on genome | 60 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
caacgataaT |
tRNA gene sequence |
GGGTGGTTGGCTTAGTGGTTAAAGCGTCCGGCTGTTAACCGGAAGACCGAGAGTTCGATT |
Downstream region at tRNA end position |
cttttttatg |
Secondary structure (Cloverleaf model) | >SRA1014829 Asn GTT T GTaa cttttttatg G - C G - C G - C T + G G + T G - C T C T T T C T C T C A T G A G | | | | | G G T T C G G A G A G C G | | | | T T T A A G C T A G AGACC T - A C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |