Sequence ID | >SRA1014830 |
Genome ID | SRR023845.334044 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 135 |
End posion on genome | 210 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gaggcaccgg |
tRNA gene sequence |
GCCGGGTTAGCTCAGTTGGTAGAGCAACCGTCTTGTAAGCGGTAGGTCGTCGGTTCGGGT |
Downstream region at tRNA end position |
tagtcctgca |
Secondary structure (Cloverleaf model) | >SRA1014830 Thr TGT g ACCA tagtcctgca G - C C - G C - G G - C G + T G - C T - A T G T C A G C C G T G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G C - G G - C T + G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |