Sequence ID | >SRA1014834 |
Genome ID | SRR023845.337069 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 61 |
End posion on genome | 134 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agagcgggaa |
tRNA gene sequence |
GGCCTCGTGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACCCCGGTTCGATTCC |
Downstream region at tRNA end position |
aatccttccc |
Secondary structure (Cloverleaf model) | >SRA1014834 Cys GCA a TCCA aatccttccc G - C G - C C - G C - G T - A C - G G - C T T T G G G C C A G A G | | | | | G T G G C G C C C G G C G | | | T T G A C G C T T A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |