Sequence ID | >SRA1014838 |
Genome ID | SRR023845.338697 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 117 |
End posion on genome | 36 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtgggcgaag |
tRNA gene sequence |
GCGGCCATGGCGAAAGGGTAGACGCACCAGTCTGAGGGACTGGCGGGAAACCGTGGAGGT |
Downstream region at tRNA end position |
actgtggtga |
Secondary structure (Cloverleaf model) | >SRA1014838 Leu GAG g ACCA actgtggtga G - C C - G G - C G - C C - G C - G A - T T A T C C T C C A G A A G | | | | | G G A G C G G G A G G C G | | | T T T A C G C A G A CGGGAAACCGT C - G C - G A - T G - C T - A C G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |