Sequence ID | >SRA1014842 |
Genome ID | SRR023845.339582 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 94 |
End posion on genome | 177 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tggtgaatcT |
tRNA gene sequence |
GTGAGTTTGCCCGAGTGGTCTAAGGGGTTACGTTCAGGTCGTAATGTTTTCGAACGCGTG |
Downstream region at tRNA end position |
catgacatga |
Secondary structure (Cloverleaf model) | >SRA1014842 Leu CAG T ATga catgacatga G - C T - A G G A - T G - C T + G T - A T A T C A C C C A T G A G | | | | | A G G C C C G T G G G C G | | | T T T A G G G C T A G TGTTTTCGAACGC T - A T - A A - T C - G G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |