Sequence ID | >SRA1014862 |
Genome ID | SRR023845.348721 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 268 |
End posion on genome | 194 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
nnnnnnnccg |
tRNA gene sequence |
GGGGCTATAGCTCAGGCGGTTAGAGCGCTTCGCTGATAACGAAGAGGTCATAGGTTCAAG |
Downstream region at tRNA end position |
agtaccggtc |
Secondary structure (Cloverleaf model) | >SRA1014862 Ile GAT g ACgc agtaccggtc G - C G - C G - C G - C C - G T - A A - T T G T T A T C C A G G A A | | | | | A C C T C G A T A G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |