Sequence ID | >SRA1014863 |
Genome ID | SRR023845.348721 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 112 |
End posion on genome | 37 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
accgggggcc |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCCTGCTTTGCAAGCAGGATGTCGGGAGTTCGATT |
Downstream region at tRNA end position |
aagaattgct |
Secondary structure (Cloverleaf model) | >SRA1014863 Ala TGC c ACGA aagaattgct G - C G - C G + T G - C C - G C - G T - A T T T C C C T C A T G A A | | | | | G T C T C G G G G A G C G | | | | T T G G A G C T A G ATGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |