Sequence ID | >SRA1014868 |
Genome ID | SRR023845.352963 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 155 |
End posion on genome | 80 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggctctaacg |
tRNA gene sequence |
GTGGCTGTAGCTCAGCTGGTAGAGTCCCAGATTGTGATTCTGGTCGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
agaacctcct |
Secondary structure (Cloverleaf model) | >SRA1014868 His GTG g CCCA agaacctcct G - C T - A G - C G - C C - G T - A G - C T G T T A C C C A C G A A + | | | | G T C T C G G T G G G C G | | | + T T G G A G T T A C TCGTC C - G C - G A - T G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |