Sequence ID | >SRA1014889 |
Genome ID | SRR023845.364886 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 145 |
End posion on genome | 61 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
agcccggcgt |
tRNA gene sequence |
GCCCCTGTGGTGAAATTGGTAGACGCGTCCGACTCAAAATCGGATTCCGCAAGGAGTGCT |
Downstream region at tRNA end position |
atttcccgga |
Secondary structure (Cloverleaf model) | >SRA1014889 Leu CAA t ACCA atttcccgga G - C C - G C - G C - G C - G T - A G - C C G T C G G C C A T A A G | | + | | G T A G T G G C T G G C G | + | T T G A C G C T A G G TTCCGCAAGGAGT T - A C - G C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |