Sequence ID | >SRA1014897 |
Genome ID | SRR023845.369648 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 97 |
End posion on genome | 186 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tcgagccctT |
tRNA gene sequence |
GGAGAGATGTCCGAGCGGCTTAAGGAACACGACTGGAAATCGTGTGTAGGTGATGAGCCT |
Downstream region at tRNA end position |
cagaaaccaa |
Secondary structure (Cloverleaf model) | >SRA1014897 Ser GGA T GTtt cagaaaccaa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T T A A TGTAGGTGATGAGCCTACC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |