Sequence ID | >SRA1014901 |
Genome ID | SRR023845.373227 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 103 |
End posion on genome | 26 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatcagcgaT |
tRNA gene sequence |
GGGCTTGTAACTCAGTTGGTTAGAGTGCCTGACTCATAATCAGTAAGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
tcataatcag |
Secondary structure (Cloverleaf model) | >SRA1014901 Met CAT T ACCC tcataatcag G - C G - C G - C C - G T + G T T G - C T G T G G A C C A T G A A | | | | | G T C T C A C C T G G C G | | | | T T G G A G T T T A G AAGTC C T C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |