Sequence ID | >SRA1014903 |
Genome ID | SRR023845.374708 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 76 |
End posion on genome | 148 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tatctaacga |
tRNA gene sequence |
GCCCGGTTAGCTCAGTTGGTAGAGCATTAGGCTTTTAACCTAATGGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
aatgttaatt |
Secondary structure (Cloverleaf model) | >SRA1014903 Lys TTT a Gtta aatgttaatt G - C C - G C - G C - G G - C G + T T - A C G T C A C C C A T G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TGGTC T - A T - A A - T G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |