Sequence ID | >SRA1014905 |
Genome ID | SRR023845.375078 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 159 |
End posion on genome | 235 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttgaagctca |
tRNA gene sequence |
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGTTCAAT |
Downstream region at tRNA end position |
tacggatagc |
Secondary structure (Cloverleaf model) | >SRA1014905 Arg ACG a ACCA tacggatagc G - C C - G G - C G - C C - G T - A G - C T T T C G T C C A T G A A | + + | | A T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |