Sequence ID | >SRA1014919 |
Genome ID | SRR023845.381096 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 45 |
End posion on genome | 121 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ccgcgacgat |
tRNA gene sequence |
GCCCCCGTAGCTCAGCCGGATAGAGCGACGGTTTCCTAAACCGTAGGCCGCGTGTTCAAA |
Downstream region at tRNA end position |
gcgtttcgtc |
Secondary structure (Cloverleaf model) | >SRA1014919 Arg CCT t ACCA gcgtttcgtc G - C C - G C - G C - G C - G C - G G - C T A T C G C T C A C G A A | | | | A C C T C G G C G T G C G | | | | T T G G A G C A T A G AGGCC A - T C - G G - C G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |