Sequence ID | >SRA1014923 |
Genome ID | SRR023845.382481 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 67 |
End posion on genome | 137 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tacatgtatg |
tRNA gene sequence |
GGGGGTGTAGTTTACCTGGTAAACGGTTGATTTGCAGTCAGTAGAAACGAGTTCAAGTCT |
Downstream region at tRNA end position |
ttgtttaggt |
Secondary structure (Cloverleaf model) | >SRA1014923 Ala TGC g Aggg ttgtttaggt G - C G - C G + T G - C G - C T - A G - C T G T T G C T C A C A A | | | | | A C T T T G A C G A G C T | | | | T T G A A A C G T G AGAA G + T T + G T - A G - C A - T T G T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |