Sequence ID | >SRA1014925 |
Genome ID | SRR023845.383578 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 103 |
End posion on genome | 179 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
accaacacat |
tRNA gene sequence |
GCACTCGTAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
tttaaagttg |
Secondary structure (Cloverleaf model) | >SRA1014925 Arg ACG t ACCA tttaaagttg G - C C - G A - T C - G T - A C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | + T T G G A G T A T A A CGGTC C - G T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |