Sequence ID | >SRA1014966 |
Genome ID | SRR023845.400879 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 155 |
End posion on genome | 231 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
cggctggtcg |
tRNA gene sequence |
CGGAGTGTAGTGCAGTCTGGTAGCGCACGTCGTTCGGGACGACGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
gaattgtctg |
Secondary structure (Cloverleaf model) | >SRA1014966 Pro CGG g ACCA gaattgtctg C - G G - C G - C A - T G - C T - A G - C T A T T C T C C A T G A A + | | | | G C C G T G G G A G G C T | | + | T T G G C G C G T A A GGGTC C - G G - C T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |