Sequence ID | >SRA1014968 |
Genome ID | SRR023845.402154 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 157 |
End posion on genome | 231 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgtgggtatg |
tRNA gene sequence |
GCGGTCTTAGCTCAGTTGGTAGAGCGCCACGTTGTGGTCGTGGATGTCACGGGTTCGAGT |
Downstream region at tRNA end position |
ccgcctttca |
Secondary structure (Cloverleaf model) | >SRA1014968 His GTG g CCAt ccgcctttca G - C C - G G - C G + T T + G C - G T - A T G T T G C C C A T G A A | | | | | G T C T C G A C G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T C - G G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |