Sequence ID | >SRA1014974 |
Genome ID | SRR023845.404342 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 243 |
End posion on genome | 167 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgcccgcagt |
tRNA gene sequence |
GCCGCTGTAGCTCAGTTGGTTAGAGCGCTTGATTGTGGATCAAGAGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
ttccttctcg |
Secondary structure (Cloverleaf model) | >SRA1014974 His GTG t ACCA ttccttctcg G + T C - G C - G G + T C - G T - A G - C C G T G G G G C A T G A A | | | | | G T C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G T - A T - A G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |