Sequence ID | >SRA1014983 |
Genome ID | SRR023845.409596 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 168 |
End posion on genome | 240 |
Amino Acid | Val |
Anticodon | AAC |
Upstream region at tRNA start position |
ccgagcatcg |
tRNA gene sequence |
GATTCCGTGGTGTAGCGGTTATCACATCTGCCTAACACGCAGAAGGTCCCCAGTTCGATC |
Downstream region at tRNA end position |
ttgctctctt |
Secondary structure (Cloverleaf model) | >SRA1014983 Val AAC g Aatt ttgctctctt G - C A - T T - A T - A C - G C - G G - C C T T G G G T C A C G A G | | | | | G G T G T G C C C A G C G | | | T T T T C A C T A A AGGTC T - A C - G T - A G - C C - G C C T A A A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |