Sequence ID | >SRA1014987 |
Genome ID | SRR023845.412025 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 39 |
End posion on genome | 124 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gcaccatcca |
tRNA gene sequence |
GTCCGGGTGGCGGAAATGGCAGACGCGCTAGCTTGAGGTGCTAGTGCCCGTATAGGGCGT |
Downstream region at tRNA end position |
gaaacactct |
Secondary structure (Cloverleaf model) | >SRA1014987 Leu GAG a ACtc gaaacactct G - C T - A C - G C - G G - C G + T G - C T G T C C C C C A A A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C C A G G TGCCCGTATAGGGCGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |