Sequence ID | >SRA1014993 |
Genome ID | SRR023845.416425 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 141 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gatacaaaaa |
tRNA gene sequence |
GCTTCCTTAGCTCAGCCGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
ttacttaaaa |
Secondary structure (Cloverleaf model) | >SRA1014993 Asn GTT a GCtt ttacttaaaa G - C C - G T - A T + G C - G C - G T - A C G T G G A C C A C G A A | | | | | G C C T C G C C T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |