Sequence ID | >SRA1014997 |
Genome ID | SRR023845.416983 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 188 |
End posion on genome | 112 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gccctggcat |
tRNA gene sequence |
GGCCTCGTAGCTCAGCTGGACAGAGCGCCGCTTTCCTAAAGCGGGCGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
gctattcgct |
Secondary structure (Cloverleaf model) | >SRA1014997 Arg CCT t ACCA gctattcgct G - C G - C C - G C - G T - A C - G G - C T G T C T C C C A C G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A C A G GCGTC C - G C - G G - C C - G T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |