Sequence ID | >SRA1015005 |
Genome ID | SRR023845.421049 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 49 |
End posion on genome | 122 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ccggtcttat |
tRNA gene sequence |
GGGGTTGTAGCTCAGTTGGTAGAGCGTCAGTTTTCCAAATTGAATGTCGCGGGTTCGAGA |
Downstream region at tRNA end position |
tggaatcctg |
Secondary structure (Cloverleaf model) | >SRA1015005 Gly TCC t TCgc tggaatcctg G - C G - C G - C G - C T - A T - A G - C A G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A G ATGTC T - A C - G A - T G + T T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |