Sequence ID | >SRA1015009 |
Genome ID | SRR023845.421782 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 228 |
End posion on genome | 152 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ccccgctcat |
tRNA gene sequence |
CGGAATGTGGCGCAGCCTGGTAGCGCACTTGTCTGGGGGACAAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tctctcccaa |
Secondary structure (Cloverleaf model) | >SRA1015009 Pro GGG t ACCA tctctcccaa C - G G - C G - C A - T A - T T - A G - C T A T C G C C C A C G A G | + | | | G C C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |