Sequence ID | >SRA1015018 |
Genome ID | SRR023845.424550 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 144 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
acgtatgcgg |
tRNA gene sequence |
GCGCCGTTGGTTTAGTGGTAAAAATATCTCGTTGCCAACGAGATGCCCCGGGTTCGATTC |
Downstream region at tRNA end position |
tcttagtgct |
Secondary structure (Cloverleaf model) | >SRA1015018 Gly GCC g Attc tcttagtgct G - C C - G G - C C - G C - G G - C T - A T T T G G C C C A T G A G | | | | | G G T T T G C C G G G C G | | | + T T T A A A T A A A TGCC T - A C - G T - A C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |