Sequence ID | >SRA1015022 |
Genome ID | SRR023845.424983 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 232 |
End posion on genome | 159 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ctccgaccat |
tRNA gene sequence |
GCGCCTATAGCTCAGTTGGTAGAGCAAGTGACTCTTAATCACTGGGTCCGGGGTTCGAGT |
Downstream region at tRNA end position |
cagaaagccc |
Secondary structure (Cloverleaf model) | >SRA1015022 Lys CTT t ACag cagaaagccc G - C C - G G - C C - G C - G T + G A - T T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T A A GGGTC A - T G - C T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |