Sequence ID | >SRA1015030 |
Genome ID | SRR023845.426224 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 130 |
End posion on genome | 45 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
acgttgtatt |
tRNA gene sequence |
GCCGAGGTGGTGGAATTGGTAGACACGCAACCTTGAGGTGGTTGTGCCCATAGGGTGTAG |
Downstream region at tRNA end position |
attagtaatc |
Secondary structure (Cloverleaf model) | >SRA1015030 Leu GAG t ACCA attagtaatc G + T C - G C - G G - C A - T G - C G + T T G T T C C C C A T A A G | | | | | G T G G T G A G G G G C G | | | T T G A C A C T A G G TGCCCATAGGGTGT C - G A - T A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |