Sequence ID | >SRA1015031 |
Genome ID | SRR023845.426254 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 91 |
End posion on genome | 180 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gattacctgc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAACGTACCGCACTCGAAATGCGGCGTACCCGCGAGGGTA |
Downstream region at tRNA end position |
tttattccct |
Secondary structure (Cloverleaf model) | >SRA1015031 Ser CGA c GCCA tttattccct G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | + T T T A C G T C G A A CGTACCCGCGAGGGTACC C - G C - G G - C C - G A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |