| Sequence ID | >SRA1015033 |
| Genome ID | SRR023845.427639 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 97 |
| End posion on genome | 172 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
ggcgcccgct |
| tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGTAGAGCGCCAGTTTTGTAAACTGGATGTCGCGGGTTCGATT |
| Downstream region at tRNA end position |
ctcctccacc |
| Secondary structure (Cloverleaf model) | >SRA1015033 Thr TGT
t ACCA ctcctccacc
G - C
C - G
C - G
G - C
G - C
T - A
T - A T T
T C G T C C A
T G A A | | + | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
A - T
G - C
T - A
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |