Sequence ID | >SRA1015033 |
Genome ID | SRR023845.427639 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 97 |
End posion on genome | 172 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggcgcccgct |
tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGTAGAGCGCCAGTTTTGTAAACTGGATGTCGCGGGTTCGATT |
Downstream region at tRNA end position |
ctcctccacc |
Secondary structure (Cloverleaf model) | >SRA1015033 Thr TGT t ACCA ctcctccacc G - C C - G C - G G - C G - C T - A T - A T T T C G T C C A T G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |