Sequence ID | >SRA1015069 |
Genome ID | SRR023845.446639 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 103 |
End posion on genome | 28 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttataataat |
tRNA gene sequence |
GGGCCCTTAGCTCAGCTGGGAGAGCACCTGCCTTGCACGCAGGGGGTCGACGGTTCGATC |
Downstream region at tRNA end position |
tatttggcgg |
Secondary structure (Cloverleaf model) | >SRA1015069 Ala TGC t ACCA tatttggcgg G - C G - C G + T C - G C - G C - G T - A C T T T T G C C A C G A A + | | | | G T C T C G G A C G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |