Sequence ID | >SRA1015090 |
Genome ID | SRR023845.457255 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 219 |
End posion on genome | 146 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
cgccaaatgt |
tRNA gene sequence |
GGGCGGTTAGTTAAATGGTATAACCTTGGTTTTACATGCCGATGTCGGGGGTTCAATTCC |
Downstream region at tRNA end position |
aatacagtgt |
Secondary structure (Cloverleaf model) | >SRA1015090 Val TAC t ACCA aatacagtgt G + T G - C G - C C - G G - C G - C T - A T T T C T C C C A A A A | + | | | A T A T T G G G G G G C G | | | | T T G T A A C T A C TGTC T - A T + G G - C G - C T + G T T T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |