Sequence ID | >SRA1015091 |
Genome ID | SRR023845.457255 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 128 |
End posion on genome | 54 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgttcatgat |
tRNA gene sequence |
GGGGCCGTAGTGGTAATGGGAGCACGATGCTTTTGCAAGGCGTAGGTGAGGGTTCGATTC |
Downstream region at tRNA end position |
tgaacactgt |
Secondary structure (Cloverleaf model) | >SRA1015091 Ala TGC t ACCA tgaacactgt G - C G - C G + T G - C C - G C - G G - C T T T C T C C C A A A T A | | | | | G T G G T G G A G G G C G | | | T T G G C A C G A G AGGT A - T T + G G - C C - G T + G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |