Sequence ID | >SRA1015095 |
Genome ID | SRR023845.458509 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 102 |
End posion on genome | 186 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gatgtcctgt |
tRNA gene sequence |
GCGGGCGTGGCGGAACTGGTAGACGCAGCAGGTTTAGGTCCTGCCATCGCAAGATGTGGG |
Downstream region at tRNA end position |
ctccgccgcc |
Secondary structure (Cloverleaf model) | >SRA1015095 Leu TAG t ACCA ctccgccgcc G - C C - G G - C G - C G - C C - G G - C T G T T T C C C A C A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G A CATCGCAAGATGT G - C C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |