Sequence ID | >SRA1015097 |
Genome ID | SRR023845.459061 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 158 |
End posion on genome | 234 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
acccccaagg |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCACTGGTTCGAA |
Downstream region at tRNA end position |
tttctcgaat |
Secondary structure (Cloverleaf model) | >SRA1015097 Arg CCG g ACCA tttctcgaat G - C C - G A - T C - G C - G C - G G - C T A T T G A C C A C G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |