Sequence ID | >SRA1015098 |
Genome ID | SRR023845.459533 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 139 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gcaacggcgt |
tRNA gene sequence |
CGGGGAGTGGCGCAGGCTGGTAGCGCACCTGGTTTGGGACCAGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttgtacgttt |
Secondary structure (Cloverleaf model) | >SRA1015098 Pro TGG t ACCA ttgtacgttt C - G G - C G - C G - C G - C A - T G - C T A T T G T C C A G G A G + | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |