Sequence ID | >SRA1015100 |
Genome ID | SRR023845.461135 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 163 |
End posion on genome | 88 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttttgctttt |
tRNA gene sequence |
AGGTCAGTAGCTCAATTGGCAGAGCGACGGTCTCCAAAACCGTAGGTTGGGGGTTCGATT |
Downstream region at tRNA end position |
gatttcctag |
Secondary structure (Cloverleaf model) | >SRA1015100 Trp CCA t GCCA gatttcctag A - T G - C G - C T - A C - G A - T G - C T T T C T C C C A T A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGTT A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |