Sequence ID | >SRA1015111 |
Genome ID | SRR023845.464383 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 252 |
End posion on genome | 181 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggtctcataa |
tRNA gene sequence |
GGTTCCGTGGCCGAGTGGCTAGGCAGTGGTCTGCAAAACCTCGTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
tttacacaaa |
Secondary structure (Cloverleaf model) | >SRA1015111 Cys GCA a TCtc tttacacaaa G - C G - C T - A T - A C - G C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A GTAC G - C T T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |