Sequence ID | >SRA1015119 |
Genome ID | SRR023845.466722 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 227 |
End posion on genome | 154 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
caagcagcaa |
tRNA gene sequence |
GCGAGAGTAGCTCAGTTGGTAGAGCATCAGCTTCCCAAGCTGAGGGTCGCGAGTTCGAAC |
Downstream region at tRNA end position |
tgattatagt |
Secondary structure (Cloverleaf model) | >SRA1015119 Gly CCC a TCat tgattatagt G - C C - G G - C A - T G - C A - T G + T C A T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |