Sequence ID | >SRA1015121 |
Genome ID | SRR023845.467167 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 49 |
End posion on genome | 123 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gtgcatgaaA |
tRNA gene sequence |
GCCCGTATGGCCCAATGGATAAGGCGCCTGCCTACGGAGCAGGAGATTCCGGGTTCGAGT |
Downstream region at tRNA end position |
ttaagagaca |
Secondary structure (Cloverleaf model) | >SRA1015121 Arg ACG A TGtt ttaagagaca G - C C - G C - G C - G G + T T - A A - T T G T G G C C C A T A A G | | | | | G G C C C G C C G G G C G | | | T T A A G G C T A G AGATT C - G C - G T - A G - C C - G C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |