Sequence ID | >SRA1015129 |
Genome ID | SRR023845.470823 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 74 |
End posion on genome | 149 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tccgggccgc |
tRNA gene sequence |
GGGCCGGTAGCTCAATGGTCAGAGCAGCGAACTCATAATTCGTCCGATGCGGGTTCGAGT |
Downstream region at tRNA end position |
gccctccgcg |
Secondary structure (Cloverleaf model) | >SRA1015129 Met CAT c ATCA gccctccgcg G - C G - C G - C C - G C - G G - C G - C T G T C G C C C A T A A A | | | | | G G C T C G G C G G G C G | | | | T T T G A G C C A A CCGAT G + T C - G G - C A - T A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |