Sequence ID | >SRA1015136 |
Genome ID | SRR023845.473643 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 184 |
End posion on genome | 111 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggtgtttgat |
tRNA gene sequence |
GCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGC |
Downstream region at tRNA end position |
ctttgctctt |
Secondary structure (Cloverleaf model) | >SRA1015136 Met CAT t ACtt ctttgctctt G - C C - G T - A C - G C - G T + G T - A C G T C G G T C A T G A G | | | | | G T C T C G G C C A G C G | | | | T T G G A G C T A G AGGTC T - A C - G A - T G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |