Sequence ID | >SRA1015143 |
Genome ID | SRR023845.476809 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 171 |
End posion on genome | 87 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cttccgaatc |
tRNA gene sequence |
GCGGGCGTGGCGAAATTGGTAGACGTGCCAGACTTAGGATCTGGTGCCGCAAGGCATGGG |
Downstream region at tRNA end position |
ttgtttaagg |
Secondary structure (Cloverleaf model) | >SRA1015143 Leu TAG c ACAA ttgtttaagg G + T C - G G - C G - C G - C C - G G - C T G T C T C C C A T A A G | + | | | G T A G C G G G G G G C G | | + T T G A C G T T A G G TGCCGCAAGGCAT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |