Sequence ID | >SRA1015146 |
Genome ID | SRR023845.477599 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 51 |
End posion on genome | 131 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cccgtgctta |
tRNA gene sequence |
GCCCGCTTGGTGAAATGGTAGACACGGTAGCCTTAAAAGCTACTCTTTTACGAGGTATCG |
Downstream region at tRNA end position |
gtgatgcggt |
Secondary structure (Cloverleaf model) | >SRA1015146 Leu TAA a Aaac gtgatgcggt G - C C - G C - G C - G G - C C - G T - A T G T T G G C C A T A A G | + | | | G G A G T G A T C G G C G | | | T T T A C A C A G G TCTTTTACGAGGT G - C T - A A - T G - C C - G C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |