Sequence ID | >SRA1015147 |
Genome ID | SRR023845.477599 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 147 |
End posion on genome | 220 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gatgcggtcg |
tRNA gene sequence |
GCAGCTATAGTTTATCGGTAAAATAGTCGACTGTGACTCGACAGTGCTGGGTTCGATTCC |
Downstream region at tRNA end position |
ttcttgtgga |
Secondary structure (Cloverleaf model) | >SRA1015147 His GTG g CCCT ttcttgtgga G - C C - G A - T G - C C - G T - A A - T T T T G A C C C A T A A | | | | | G C T T T G C T G G G C G | | | + T T G A A A T T A A AGTG G - C T - A C - G G - C A - T C C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |